Editing Alu element (section)

=={{anchor|7SL RNA}}Sequence features==
[[File:LINE1s and SINEs.png|thumb|Genetic structure of [[murine]] [[LINE1]] and SINEs, including Alu.]]

Two main promoter "boxes" are found in Alu: a 5' A box with the consensus {{tt|TGGCTCACGCC}}, and a 3' B box with the consensus {{tt|GTTCGAGAC}} (IUPAC [[nucleic acid notation]]). [[tRNA]]s, which are transcribed by [[RNA polymerase III]], have a similar but stronger promoter structure.<ref>{{cite journal |last1=Conti |first1=A |last2=Carnevali |first2=D |last3=Bollati |first3=V |last4=Fustinoni |first4=S |last5=Pellegrini |first5=M |last6=Dieci |first6=G |title=Identification of RNA polymerase III-transcribed Alu loci by computational screening of RNA-Seq data. |journal=Nucleic Acids Research |date=January 2015 |volume=43 |issue=2 |pages=817–35 |doi=10.1093/nar/gku1361 |pmid=25550429 |pmc=4333407}}</ref> Both boxes are located in the left arm.<ref name=pmid17020921/>

Alu elements contain four or fewer [[Retinoic Acid]] response element hexamer sites in its internal [[Promoter (biology)|promoter]], with the last one overlapping with the "B box".<ref name=pmid7667273>{{cite journal |doi=10.1073/pnas.92.18.8229 |pmid=7667273 |pmc=41130 |title=The consensus sequence of a major Alu subfamily contains a functional retinoic acid response element |journal=Proceedings of the National Academy of Sciences |volume=92 |issue=18 |pages=8229–33 |year=1995 |last1=Vansant |first1=G |last2=Reynolds |first2=W. F |bibcode=1995PNAS...92.8229V |doi-access=free }}</ref> In this 7SL ([[Signal recognition particle RNA|SRP]]) RNA example below, functional hexamers are underlined using a solid line, with the non-functional third hexamer denoted using a dotted line:

{{tt|1=<span style="line-break: anywhere">GCCGGGCGCGGTGGCGCGTGCCTGTAGTCCCAGCTACTCGGG<u>AGGCTG</u>AGGCTGGA<u>GGATCG</u>CTTG<u style="text-decoration-style: dotted;">AGTCCA</u>GG'''<u>AGTTCT</u>GGGCT'''GTAGTGCGCTATGCCGATCGGAATAGCCACTGCACTCCAGCCTGGGCAACATAGCGAGACCCCGTCTC</span>}}.

The recognition sequence of the ''[[Arthrobacter luteus|Alu I]]'' endonuclease is 5' ag/ct 3'; that is, the enzyme cuts the DNA segment between the [[guanine]] and [[cytosine]] residues (in lowercase above).<ref>{{cite journal | journal=Nature | date=1984 | volume=312 |issue=5990 | pages=171–2 | title=Alu sequences are processed 7SL RNA genes | author=Ullu E, Tschudi C | pmid= 6209580| doi=10.1038/312171a0 | bibcode=1984Natur.312..171U | s2cid=4328237 }}</ref>