Editing Transfer RNA (section)

==tRNA genes==
Organisms vary in the number of tRNA [[genes]] in their [[genome]]. For example, the [[nematode]] worm ''[[Caenorhabditis elegans|C. elegans]]'', a commonly used model organism in [[genetics]] studies, has 29,647 genes in its [[cell nucleus|nuclear]] genome,<ref>WormBase web site, http://www.wormbase.org {{Webarchive|url=https://web.archive.org/web/20170420234209/http://www.wormbase.org/ |date=2017-04-20 }}, release WS187, date 25-Jan-2008.</ref> of which 620 code for tRNA.<ref>{{cite journal | vauthors = Spieth J, Lawson D | title = Overview of gene structure | journal = WormBook | pages = 1–10 | date = January 2006 | pmid = 18023127 | pmc = 4781370 | doi = 10.1895/wormbook.1.65.1 }}</ref><ref>Hartwell LH, Hood L, Goldberg ML, Reynolds AE, Silver LM, Veres RC. (2004). ''Genetics: From Genes to Genomes'' 2nd ed. McGraw-Hill: New York. p. 264.</ref> The budding yeast ''[[Saccharomyces cerevisiae]]'' has 275 tRNA genes in its genome. The number of tRNA genes per genome can vary widely, with bacterial species from groups such as Fusobacteria and Tenericutes having around 30 genes per genome while complex eukaryotic genomes such as the zebrafish (''Danio rerio'') can bear more than 10 thousand tRNA genes.<ref name=":0" />

In the human genome, which, according to January 2013 estimates, has about 20,848 protein coding genes <ref>Ensembl release 70 - Jan 2013 http://www.ensembl.org/Homo_sapiens/Info/StatsTable?db=core {{Webarchive|url=https://web.archive.org/web/20131215071631/http://www.ensembl.org/Homo_sapiens/Info/StatsTable?db=core |date=2013-12-15 }}</ref> in total, there are 497 nuclear genes encoding cytoplasmic tRNA molecules, and 324 tRNA-derived [[pseudogenes]]—tRNA genes thought to be no longer functional<ref name="Lander">{{cite journal | vauthors = Lander ES, Linton LM, Birren B, Nusbaum C, Zody MC, Baldwin J, etal | collaboration = International Human Genome Sequencing Consortium | title = Initial sequencing and analysis of the human genome | journal = Nature | volume = 409 | issue = 6822 | pages = 860–921 | date = February 2001 | pmid = 11237011 | doi = 10.1038/35057062 | bibcode = 2001Natur.409..860L | url = https://deepblue.lib.umich.edu/bitstream/2027.42/62798/1/409860a0.pdf | doi-access = free }}</ref> (although pseudo tRNAs have been shown to be involved in [[antimicrobial resistance|antibiotic resistance]] in bacteria).<ref name="Rogers12">{{cite journal | vauthors = Rogers TE, Ataide SF, Dare K, Katz A, Seveau S, Roy H, Ibba M | title = A pseudo-tRNA modulates antibiotic resistance in Bacillus cereus | journal = PLOS ONE | volume = 7 | issue = 7 | pages = e41248 | year = 2012 | pmid = 22815980 | pmc = 3399842 | doi = 10.1371/journal.pone.0041248 | bibcode = 2012PLoSO...741248R | doi-access = free }}</ref> As with all eukaryotes, there are 22 [[mitochondria]]l tRNA genes<ref>Hartwell LH, Hood L, Goldberg ML, Reynolds AE, Silver LM, Veres RC. (2004). ''Genetics: From Genes to Genomes'' 2nd ed. McGraw-Hill: New York. p. 529.</ref> in humans. Mutations in some of these genes have been associated with severe diseases like the [[MELAS syndrome]]. Regions in nuclear [[chromosomes]], very similar in sequence to mitochondrial tRNA genes, have also been identified (tRNA-lookalikes).<ref name="Telonis14">{{cite journal | vauthors = Telonis AG, Loher P, Kirino Y, Rigoutsos I | title = Nuclear and mitochondrial tRNA-lookalikes in the human genome | journal = Frontiers in Genetics | volume = 5 | page = 344 | year = 2014 | pmid = 25339973 | pmc = 4189335 | doi = 10.3389/fgene.2014.00344 | doi-access = free }}</ref> These tRNA-lookalikes are also considered part of the [[Numt|nuclear mitochondrial DNA]] (genes transferred from the mitochondria to the nucleus).<ref name="Telonis14" /><ref name="Ramos11">{{cite journal | vauthors = Ramos A, Barbena E, Mateiu L, del Mar González M, Mairal Q, Lima M, Montiel R, Aluja MP, Santos C | title = Nuclear insertions of mitochondrial origin: Database updating and usefulness in cancer studies | journal = Mitochondrion | volume = 11 | issue = 6 | pages = 946–953 | date = November 2011 | pmid = 21907832 | doi = 10.1016/j.mito.2011.08.009 | display-authors = etal }}</ref> The phenomenon of multiple nuclear copies of mitochondrial tRNA (tRNA-lookalikes) has been observed in many higher organisms from human to the opossum<ref name="Telonis15-look">{{cite journal | vauthors = Telonis AG, Kirino Y, Rigoutsos I | title = Mitochondrial tRNA-lookalikes in nuclear chromosomes: Could they be functional? | journal = RNA Biol | volume = 12 | issue = 4 | year = 2015 | pages = 375–380 | pmid = 25849196 | pmc = 4615777 | doi = 10.1080/15476286.2015.1017239 }}</ref> suggesting the possibility that the lookalikes are functional.

Cytoplasmic tRNA genes can be grouped into 49 families according to their anticodon features. These genes are found on all chromosomes, except the 22 and Y chromosome. High clustering on 6p is observed (140 tRNA genes), as well as on chromosome 1.<ref name="Lander" />

The [[HUGO Gene Nomenclature Committee|HGNC]], in collaboration with the Genomic tRNA Database ([http://gtrnadb.ucsc.edu/ GtRNAdb]) and experts in the field, has approved unique names for human genes that encode tRNAs.

Typically, tRNAs genes from Bacteria are shorter (mean = 77.6 bp) than tRNAs from Archaea (mean = 83.1 bp) and eukaryotes (mean = 84.7 bp).<ref name=":0">{{Cite journal |last1=Santos |first1=Fenícia Brito |last2=Del-Bem |first2=Luiz-Eduardo |date=January 2023 |title=The Evolution of tRNA Copy Number and Repertoire in Cellular Life |journal=Genes |language=en |volume=14 |issue=1 |pages=27 |doi=10.3390/genes14010027 |pmid=36672768 |pmc=9858662 |issn=2073-4425|doi-access=free }}</ref> The mature tRNA follows an opposite pattern with tRNAs from Bacteria being usually longer (median = 77.6 nt) than tRNAs from Archaea (median = 76.8 nt), with eukaryotes exhibiting the shortest mature tRNAs (median = 74.5 nt).<ref name=":0" />

===Evolution===
Genomic tRNA content is a differentiating feature of genomes among biological domains of life: Archaea present the simplest situation in terms of genomic tRNA content with a uniform number of gene copies, Bacteria have an intermediate situation and Eukarya present the most complex situation.<ref name="evamaria">{{cite journal | vauthors = Novoa EM, Pavon-Eternod M, Pan T, Ribas de Pouplana L | title = A role for tRNA modifications in genome structure and codon usage | journal = Cell | volume = 149 | issue = 1 | pages = 202–213 | date = March 2012 | pmid = 22464330 | doi = 10.1016/j.cell.2012.01.050 | s2cid = 16487609 | doi-access = free }}</ref> Eukarya present not only more tRNA gene content than the other two kingdoms but also a high variation in [[gene copy number]] among different isoacceptors, and this complexity seem to be due to duplications of tRNA genes and changes in anticodon specificity {{citation needed |date=September 2015}}.

Evolution of the tRNA gene copy number across different species has been linked to the appearance of specific tRNA modification enzymes (uridine methyltransferases in Bacteria, and adenosine deaminases in Eukarya), which increase the decoding capacity of a given tRNA.<ref name="evamaria" /> As an example, tRNA<sup>Ala</sup> encodes four different tRNA isoacceptors (AGC, UGC, GGC and CGC). In Eukarya, AGC isoacceptors are extremely enriched in gene copy number in comparison to the rest of isoacceptors, and this has been correlated with its A-to-I modification of its wobble base. This same trend has been shown for most amino acids of eukaryal species. Indeed, the effect of these two tRNA modifications is also seen in [[codon usage bias]]. Highly expressed genes seem to be enriched in codons that are exclusively using codons that will be decoded by these modified tRNAs, which suggests a possible role of these codons—and consequently of these tRNA modifications—in translation efficiency.<ref name="evamaria" />

Many species have lost specific tRNAs during evolution. For instance, both mammals and birds lack the same 14 out of the possible 64 tRNA genes, but other life forms contain these tRNAs.<ref>{{cite journal | vauthors = Ou X, Peng W, Yang Z, Cao J, Wang M, Peppelenbosch MP, Pan Q, Cheng A | title = Evolutionarily missing and conserved tRNA genes in human and avian. | journal = Infect. Genet. Evol.| volume = 85 | pages = 104460 | date = November 2020 | pmid = 32679345 | doi = 10.1016/j.meegid.2020.104460 | doi-access = free | bibcode = 2020InfGE..8504460O | hdl = 1765/129010 | hdl-access = free }}</ref> For translating codons for which an exactly pairing tRNA is missing, organisms resort to a strategy called [[Wobble base pair|wobbling]], in which imperfectly matched tRNA/mRNA pairs still give rise to translation, although this strategy also increases the propensity for translation errors.<ref>{{cite journal | vauthors = Ou X, Cao J, Cheng A, Peppelenbosch MP, Pan Q | title = Errors in translational decoding: tRNA wobbling or misincorporation? | journal = PLOS Genetics | volume = 15 | issue = 3 | pages = 2979–2986 | date = March 2019 | pmid = 21930591 | pmc = 3158919 | doi = 10.1371/journal.pgen.1008017 | doi-access = free }}</ref> The reasons why tRNA genes have been lost during evolution remains under debate but may relate improving resistance to viral infection.<ref>{{cite journal | vauthors = Ou X, Wang M, Mao S, Cao J, Cheng A, Zhu D, Chen S, Jia R, Liu M, Yang Q, Wu Y, Zhao X, Zhang S, Liu Y, Yu Y, Zhang L, Chen X, Peppelenbosch MP, Pan Q | title = Incompatible Translation Drives a Convergent Evolution and Viral Attenuation During the Development of Live Attenuated Vaccine | journal = Front. Cell. Infect. Microbiol. | volume = 8 | pages = 249 | date = July 2018 | pmid = 30073153 | pmc = 6058041 | doi = 10.3389/fcimb.2018.00249 | doi-access = free }}</ref> Because nucleotide triplets can present more combinations than there are amino acids and associated tRNAs, there is redundancy in the genetic code, and several different 3-nucleotide codons can express the same amino acid. This codon bias is what necessitates codon optimization.

==== Hypothetical origin ====
The top half of tRNA (consisting of the T arm and the acceptor stem with 5′-terminal phosphate group and 3′-terminal CCA group) and the bottom half (consisting of the D arm and the anticodon arm) are independent units in structure as well as in function. The top half may have evolved first including the 3′-terminal genomic tag which originally may have marked tRNA-like molecules for replication in early [[RNA world]]. The bottom half may have evolved later as an expansion, e.g. as protein synthesis started in RNA world and turned it into a ribonucleoprotein world ([[RNP world]]). This proposed scenario is called [[genomic tag hypothesis]]. In fact, tRNA and tRNA-like aggregates have an important catalytic influence (i.e., as [[ribozyme]]s) on replication still today. These roles may be regarded as '[[molecular fossil|molecular (or chemical) fossils]]' of RNA world.<ref name="MW_GenomicTag">{{cite book| first1= Nancy| last1= Maizels| first2= Alan M.| last2= Weiner| chapter-url= http://citeseerx.ist.psu.edu/viewdoc/summary?doi=10.1.1.708.7795 |chapter= The Genomic Tag Hypothesis – What Molecular Fossils Tell Us about the Evolution of tRNA| title= The RNA World| edition= 2nd| year= 1999| publisher= Cold Spring Harbor Laboratory Press | citeseerx= 10.1.1.708.7795|isbn= 978-0-87969-561-3| access-date= February 16, 2024}}</ref> In March 2021, researchers reported evidence suggesting that an early form of transfer RNA could have been a replicator [[ribozyme]] molecule in the very early development of life, or [[abiogenesis]].<ref name="EL-20210302">{{cite journal |last1=Kühnlein |first1=Alexandra |last2=Lanzmich |first2=Simon A. |last3=Brun |first3=Dieter |title=tRNA sequences can assemble into a replicator |doi=10.7554/eLife.63431 |date=2 March 2021 |journal=[[eLife]] |volume=10 |pmid=33648631 |pmc=7924937 |doi-access=free }}</ref><ref name="STD-20210403">{{cite news |last=Maximilian |first=Ludwig |title=Solving the Chicken-and-the-Egg Problem – "A Step Closer to the Reconstruction of the Origin of Life" |url=https://scitechdaily.com/solving-the-chicken-and-the-egg-problem-a-step-closer-to-the-reconstruction-of-the-origin-of-life/ |date=3 April 2021 |work=[[SciTech (magazine)|SciTechDaily]] |accessdate=3 April 2021 }}</ref>

Evolution of type I and type II tRNAs is explained to the last nucleotide by the three 31 nucleotide minihelix tRNA evolution theorem, which also describes the pre-life to life transition on Earth.<ref>{{cite journal |journal=Life |title=The 3 31 Nucleotide Minihelix tRNA Evolution Theorem and the Origin of Life |doi=10.3390/life13112224 |doi-access=free |date=2023 |last1=Lei |first1=Lei |last2=Burton |first2=Zachary Frome |volume=13 |issue=11 |page=2224 |pmid=38004364 |pmc=10672568 |bibcode=2023Life...13.2224L }}</ref><ref>{{cite journal |journal=Transcription |last1=Lei |first1=Lei |last2=Burton |first2=Zachary |title=Evolution of the genetic code |doi=10.1080/21541264.2021.1927652 |date=2021 |volume=12 |issue=1 |pages=28–53 |pmid=34000965 |pmc=8172153 }}</ref><ref>{{cite journal |journal=Life |last1=Lei |first1=Lei |last2=Burton |first2=Zachary |title=Evolution of Life on Earth: tRNA, Aminoacyl-tRNA Synthetases and the Genetic Code |doi=10.3390/life10030021 |doi-access=free |date=2021 |volume=10 |issue=3 |page=21 |pmid=32131473 |pmc=7151597 }}</ref><ref>{{cite journal |journal=J Mol Evol |last1=Burton |first1=Zachary |title= The 3-Minihelix tRNA Evolution Theorem |doi=10.1007/s00239-020-09928-2 |date=2020 |volume=88 |issue=3 |pages=234–242 |pmid=32020280 |bibcode=2020JMolE..88..234B }}</ref><ref>{{cite journal |journal=Life | last1=Kim |first1=Yunsoo |last2=Opron |first2=Kristopher |last3=Burton |first3=Zachary |title= A tRNA- and Anticodon-Centric View of the Evolution of Aminoacyl-tRNA Synthetases, tRNAomes, and the Genetic Code | doi= 10.3390/life9020037 |date=2019 |volume=9 |issue=2 |page=37 |doi-access=free |pmid=31060233 |pmc=6616430 | bibcode=2019Life....9...37K }}</ref> Three 31 nucleotide minihelices of known sequence were ligated in pre-life to generate a 93 nucleotide tRNA precursor. In pre-life, a 31 nucleotide D loop minihelix (GCGGCGGUAGCCUAGCCUAGCCUACCGCCGC) was ligated to two 31 nucleotide anticodon loop minihelices (GCGGCGGCCGGGCU/???AACCCGGCCGCCGC; / indicates a U-turn conformation in the RNA backbone; ? indicates unknown base identity) to form the 93 nucleotide tRNA precursor. To generate type II tRNAs, a single internal 9 nucleotide deletion occurred within ligated acceptor stems (CCGCCGCGCGGCGG goes to GGCGG). To generate type I tRNAs, an additional, related 9 nucleotide deletion occurred within ligated acceptor stems within the variable loop region (CCGCCGCGCGGCGG goes to CCGCC). These two 9 nucleotide deletions are identical on complementary RNA strands. tRNAomes (all of the tRNAs of an organism) were generated by duplication and mutation.

Very clearly, life evolved from a polymer world that included RNA repeats and RNA inverted repeats (stem-loop-stems). Of particular importance were the 7 nucleotide U-turn loops (CU/???AA). After LUCA (the last universal common (cellular) ancestor), the T loop evolved to interact with the D loop at the tRNA “elbow” (T loop: UU/CAAAU, after LUCA). Polymer world progressed to minihelix world to tRNA world, which has endured for ~4 billion years. Analysis of tRNA sequences reveals a major successful pathway in evolution of life on Earth.

===tRNA-derived fragments===
tRNA-derived fragments (or tRFs) are short molecules that emerge after cleavage of the mature tRNAs or the precursor transcript.<ref name="Gebetsberger13">{{cite journal | vauthors = Gebetsberger J, Polacek N | title = Slicing tRNAs to boost functional ncRNA diversity | journal = RNA Biology | volume = 10 | issue = 12 | pages = 1798–1806 | date = December 2013 | pmid = 24351723 | pmc = 3917982 | doi = 10.4161/rna.27177 }}</ref><ref name="Shigematsu14">{{cite journal | vauthors = Shigematsu M, Honda S, Kirino Y | title = Transfer RNA as a source of small functional RNA | journal = Journal of Molecular Biology and Molecular Imaging | volume = 1 | issue = 2 | page = 8 | year = 2014 | pmid = 26389128 | pmc = 4572697 }}</ref><ref name="Sobala11">{{cite journal | vauthors = Sobala A, Hutvagner G | title = Transfer RNA-derived fragments: origins, processing, and functions | journal = Wiley Interdisciplinary Reviews: RNA | volume = 2 | issue = 6 | pages = 853–862 | year = 2011 | pmid = 21976287 | doi = 10.1002/wrna.96 | hdl = 10453/18187 | s2cid = 206554146 | url = https://opus.lib.uts.edu.au/bitstream/10453/18187/1/2011002529.pdf | hdl-access = free }}</ref><ref name="Keam15">{{cite journal | vauthors = Keam SP, Hutvagner G | title = tRNA-Derived Fragments (tRFs): Emerging New Roles for an Ancient RNA in the Regulation of Gene Expression | journal = Life | volume = 5 | issue = 4 | pages = 1638–1651 | date = November 2015 | pmid = 26703738 | pmc = 4695841 | doi = 10.3390/life5041638 | bibcode = 2015Life....5.1638K | doi-access = free }}</ref> Both cytoplasmic and mitochondrial tRNAs can produce fragments.<ref name="Telonis15-dissect">{{cite journal | vauthors = Telonis AG, Loher P, Honda S, Jing Y, Palazzo J, Kirino Y, Rigoutsos I | title = Dissecting tRNA-derived fragment complexities using personalized transcriptomes reveals novel fragment classes and unexpected dependencies | journal = Oncotarget | volume = 6 | issue = 28 | pages = 24797–822 | date = July 2015 | pmid = 26325506 | pmc = 4694795 | doi = 10.18632/oncotarget.4695}}</ref> There are at least four structural types of tRFs believed to originate from mature tRNAs, including the relatively long tRNA halves and short 5'-tRFs, 3'-tRFs and i-tRFs.<ref name="Gebetsberger13" /><ref name="Telonis15-dissect" /><ref name="Kumar14">{{cite journal | vauthors = Kumar P, Anaya J, Mudunuri SB, Dutta A | title = Meta-analysis of tRNA derived RNA fragments reveals that they are evolutionarily conserved and associate with AGO proteins to recognize specific RNA targets | journal = BMC Biology | volume = 12 | page = 78 | date = October 2014 | pmid = 25270025 | pmc = 4203973 | doi = 10.1186/s12915-014-0078-0 | doi-access = free }}</ref> The precursor tRNA can be cleaved to produce molecules from the 5' leader or 3' trail sequences. Cleavage enzymes include Angiogenin, Dicer, RNase Z and RNase P.<ref name="Gebetsberger13" /><ref name="Shigematsu14" /> Especially in the case of Angiogenin, the tRFs have a characteristically unusual cyclic phosphate at their 3' end and a hydroxyl group at the 5' end.<ref name="Honda15">{{cite journal | vauthors = Honda S, Loher P, Shigematsu M, Palazzo JP, Suzuki R, Imoto I, Rigoutsos I, Kirino Y | title = Sex hormone-dependent tRNA halves enhance cell proliferation in breast and prostate cancers | journal = Proceedings of the National Academy of Sciences of the United States of America | volume = 112 | issue = 29 | pages = E3816–E3825 | date = July 2015 | pmid = 26124144 | pmc = 4517238 | doi = 10.1073/pnas.1510077112 | bibcode = 2015PNAS..112E3816H | doi-access = free }}</ref> tRFs appear to play a role in [[RNA interference]], specifically in the suppression of retroviruses and retrotransposons that use tRNA as a primer for replication. Half-tRNAs cleaved by [[angiogenin]] are also known as tiRNAs. The biogenesis of smaller fragments, including those that function as [[piRNA]]s, are less understood.<ref name="pmid29934075">{{cite journal |last1=Schorn |first1=AJ |last2=Martienssen |first2=R |title=Tie-Break: Host and Retrotransposons Play tRNA. |journal=Trends in Cell Biology |date=October 2018 |volume=28 |issue=10 |pages=793–806 |doi=10.1016/j.tcb.2018.05.006 |pmid=29934075|pmc=6520983 }}</ref>

tRFs have multiple dependencies and roles; such as exhibiting significant changes between sexes, among races and disease status.<ref name="Telonis15-dissect" /><ref name="Telonis18">{{cite journal | vauthors = Telonis AG, Rigoutsos I | title = Race Disparities in the Contribution of miRNA Isoforms and tRNA-Derived Fragments to Triple-Negative Breast Cancer | journal = Cancer Res | volume = 78 | issue = 5 | pages = 1140–54 | date = March 2018 | pmid = 29229607 | pmc = 5935570 | doi = 10.1158/0008-5472.CAN-17-1947}}</ref><ref name="Telonis19">{{cite journal | vauthors = Telonis AG, Loher P, Magee R, Pliatsika V, Londin E, Kirino Y, Rigoutsos I | title = tRNA Fragments Show Intertwining with mRNAs of Specific Repeat Content and Have Links to Disparities | journal = Cancer Res | volume = 79 | issue = 12 | pages = 3034–49 | date = Jun 2019 | pmid = 30996049 | pmc = 6571059 | doi = 10.1158/0008-5472.CAN-19-0789}}</ref> Functionally, they can be loaded on Ago and act through RNAi pathways,<ref name="Sobala11" /><ref name="Kumar14" /><ref name="Shigematsu15">{{cite journal | vauthors = Shigematsu M, Kirino Y | title = tRNA-Derived Short Non-coding RNA as Interacting Partners of Argonaute Proteins | journal = Gene Regulation and Systems Biology | volume = 9 | pages = 27–33 | year = 2015 | pmid = 26401098 | pmc = 4567038 | doi = 10.4137/GRSB.S29411 }}</ref> participate in the formation of stress granules,<ref name="Emara10">{{cite journal | vauthors = Emara MM, Ivanov P, Hickman T, Dawra N, Tisdale S, Kedersha N, Hu GF, Anderson P | title = Angiogenin-induced tRNA-derived stress-induced RNAs promote stress-induced stress granule assembly | journal = The Journal of Biological Chemistry | volume = 285 | issue = 14 | pages = 10959–10968 | date = April 2010 | pmid = 20129916 | pmc = 2856301 | doi = 10.1074/jbc.M109.077560 | doi-access = free }}</ref> displace mRNAs from RNA-binding proteins<ref name="Goodarzi15">{{cite journal | vauthors = Goodarzi H, Liu X, Nguyen HC, Zhang S, Fish L, Tavazoie SF | title = Endogenous tRNA-Derived Fragments Suppress Breast Cancer Progression via YBX1 Displacement | journal = Cell | volume = 161 | issue = 4 | pages = 790–802 | date = May 2015 | pmid = 25957686 | pmc = 4457382 | doi = 10.1016/j.cell.2015.02.053 }}</ref> or inhibit translation.<ref name="Ivanov11">{{cite journal | vauthors = Ivanov P, Emara MM, Villen J, Gygi SP, Anderson P | title = Angiogenin-induced tRNA fragments inhibit translation initiation | journal = Molecular Cell | volume = 43 | issue = 4 | pages = 613–623 | date = August 2011 | pmid = 21855800 | pmc = 3160621 | doi = 10.1016/j.molcel.2011.06.022 }}</ref> At the system or the organismal level, the four types of tRFs have a diverse spectrum of activities. Functionally, tRFs are associated with viral infection,<ref name="Selitsky15">{{cite journal | vauthors = Selitsky SR, Baran-Gale J, Honda M, Yamane D, Masaki T, Fannin EE, Guerra B, Shirasaki T, Shimakami T, Kaneko S, Lanford RE, Lemon SM, Sethupathy P | title = Small tRNA-derived RNAs are increased and more abundant than microRNAs in chronic hepatitis B and C | journal = Scientific Reports | volume = 5 | page = 7675 | date = January 2015 | pmid = 25567797 | pmc = 4286764 | doi = 10.1038/srep07675 | bibcode = 2015NatSR...5.7675S }}</ref> cancer,<ref name="Kumar14" /> cell proliferation <ref name="Honda15" /> and also with epigenetic transgenerational regulation of metabolism.<ref name="Sharma16">{{cite journal | vauthors = Sharma U, Conine CC, Shea JM, Boskovic A, Derr AG, Bing XY, Belleannee C, Kucukural A, Serra RW, Sun F, Song L, Carone BR, Ricci EP, Li XZ, Fauquier L, Moore MJ, Sullivan R, Mello CC, Garber M, Rando OJ | title = Biogenesis and function of tRNA fragments during sperm maturation and fertilization in mammals | journal = Science | volume = 351 | issue = 6271 | pages = 391–396 | date = January 2016 | pmid = 26721685 | pmc = 4888079 | doi = 10.1126/science.aad6780 | bibcode = 2016Sci...351..391S }}</ref>

tRFs are not restricted to humans and have been shown to exist in multiple organisms.<ref name="Kumar14" /><ref name="Casas15">{{cite journal | vauthors = Casas E, Cai G, Neill JD | title = Characterization of circulating transfer RNA-derived RNA fragments in cattle | journal = Frontiers in Genetics | volume = 6 | page = 271 | year = 2015 | pmid = 26379699 | pmc = 4547532 | doi = 10.3389/fgene.2015.00271 | doi-access = free }}</ref><ref name="Hirose15">{{cite journal | vauthors = Hirose Y, Ikeda KT, Noro E, Hiraoka K, Tomita M, Kanai A | title = Precise mapping and dynamics of tRNA-derived fragments (tRFs) in the development of Triops cancriformis (tadpole shrimp) | journal = BMC Genetics | volume = 16 | page = 83 | date = July 2015 | pmid = 26168920 | pmc = 4501094 | doi = 10.1186/s12863-015-0245-5 | doi-access = free }}</ref><ref name="Karaiskos15">{{cite journal | vauthors = Karaiskos S, Naqvi AS, Swanson KE, Grigoriev A | title = Age-driven modulation of tRNA-derived fragments in Drosophila and their potential targets | journal = Biology Direct | volume = 10 | page = 51 | date = September 2015 | pmid = 26374501 | pmc = 4572633 | doi = 10.1186/s13062-015-0081-6 | doi-access = free }}</ref>

Two online tools are available for those wishing to learn more about tRFs: the framework for the interactive exploration of <u>mi</u>tochondrial and <u>n</u>uclear <u>t</u>RNA fragments ([https://cm.jefferson.edu/MINTbase/ MINTbase])<ref name="Pliatsika16">{{cite journal | vauthors = Pliatsika V, Loher P, Telonis AG, Rigoutsos I | title = MINTbase: a framework for the interactive exploration of mitochondrial and nuclear tRNA fragments | journal = Bioinformatics | volume = 32 | issue = 16 | pages = 2481–2489 | date = August 2016 | pmid = 27153631 | pmc = 4978933 | doi = 10.1093/bioinformatics/btw194 }}</ref><ref name="Pliatsika18">{{cite journal | vauthors = Pliatsika V, Loher P, Magee R, Telonis AG, Londin E, Shigematsu M, Kirino Y, Rigoutsos I | title = MINTbase v2.0: a comprehensive database for tRNA-derived fragments that includes nuclear and mitochondrial fragments from all The Cancer Genome Atlas projects | journal = Nucleic Acids Research | volume = 46(D1) | pages = D152–D159 | date = January 2018 | issue = D1 | pmid = 29186503 | pmc = 5753276 | doi = 10.1093/nar/gkx1075}}</ref> and the relational database of <u>T</u>ransfer <u>R</u>NA related <u>F</u>ragments ([http://genome.bioch.virginia.edu/trfdb/ tRFdb]).<ref name="Kumar15">{{cite journal | vauthors = Kumar P, Mudunuri SB, Anaya J, Dutta A | title = tRFdb: a database for transfer RNA fragments | journal = Nucleic Acids Research | volume = 43 | issue = Database issue | pages = D141-5 | date = January 2015 | pmid = 25392422 | pmc = 4383946 | doi = 10.1093/nar/gku1138 }}</ref> MINTbase also provides a naming scheme for the naming of tRFs called [https://cm.jefferson.edu/MINTcodes/ tRF-license plates] (or MINTcodes) that is genome independent; the scheme compresses an RNA sequence into a shorter string.

=== Engineered tRNAs ===
{{main|Genetic code expansion}}
tRNAs with modified anticodons and/or acceptor stems can be used to modify the genetic code. Scientists have successfully repurposed codons (sense and stop) to accept amino acids (natural and novel), for both initiation (see: [[start codon]]) and elongation.

In 1990, tRNA{{sup sub|fMet2|CUA}} (modified from the tRNA{{sup sub|fMet2|CAU}} gene [https://ecocyc.org/gene?orgid=ECOLI&id=EG30061 metY]) was inserted into ''E. coli'', causing it to initiate protein synthesis at the UAG stop codon, as long as it is preceded by a strong [[Shine-Dalgarno sequence]]. At initiation it not only inserts the traditional [[formylmethionine]], but also formylglutamine, as glutamyl-tRNA synthase also recognizes the new tRNA.<ref>{{cite journal |last1=Varshney |first1=U |last2=RajBhandary |first2=U L |title=Initiation of protein synthesis from a termination codon. |journal=Proceedings of the National Academy of Sciences |date=February 1990 |volume=87 |issue=4 |pages=1586–1590 |doi=10.1073/pnas.87.4.1586|doi-access=free |pmid=2406724 |pmc=53520 |bibcode=1990PNAS...87.1586V }}</ref> The experiment was repeated in 1993, now with an elongator tRNA modified to be recognized by the [[methionyl-tRNA formyltransferase]].<ref>{{cite journal |last1=Varshney |first1=U |last2=Lee |first2=C P |last3=RajBhandary |first3=U L |title=From elongator tRNA to initiator tRNA. |journal=Proceedings of the National Academy of Sciences |date=15 March 1993 |volume=90 |issue=6 |pages=2305–2309 |doi=10.1073/pnas.90.6.2305|doi-access=free |pmid=8460138 |pmc=46075 |bibcode=1993PNAS...90.2305V }}</ref> A similar result was obtained in ''[[Mycobacterium]]''.<ref>{{cite journal | vauthors = Govindan A, Miryala S, Mondal S, Varshney U | title = Development of Assay Systems for Amber Codon Decoding at the Steps of Initiation and Elongation in Mycobacteria | journal = Journal of Bacteriology | volume = 200 | issue = 22 | date = November 2018 | pmid = 30181124 | pmc = 6199473 | doi = 10.1128/jb.00372-18 }}</ref> Later experiments showed that the new tRNA was orthogonal to the regular AUG start codon showing no detectable off-target translation initiation events in a genomically recoded ''E. coli'' strain.<ref name="fmet2-cua-ec">{{cite journal | vauthors = Vincent RM, Wright BW, Jaschke PR | title = Measuring Amber Initiator tRNA Orthogonality in a Genomically Recoded Organism | journal = ACS Synthetic Biology | volume = 8 | issue = 4 | pages = 675–685 | date = April 2019 | pmid = 30856316 | doi = 10.1021/acssynbio.9b00021 | s2cid = 75136654 }}</ref>