Editing Transfer RNA (section)

===Evolution===
Genomic tRNA content is a differentiating feature of genomes among biological domains of life: Archaea present the simplest situation in terms of genomic tRNA content with a uniform number of gene copies, Bacteria have an intermediate situation and Eukarya present the most complex situation.<ref name="evamaria">{{cite journal | vauthors = Novoa EM, Pavon-Eternod M, Pan T, Ribas de Pouplana L | title = A role for tRNA modifications in genome structure and codon usage | journal = Cell | volume = 149 | issue = 1 | pages = 202–213 | date = March 2012 | pmid = 22464330 | doi = 10.1016/j.cell.2012.01.050 | s2cid = 16487609 | doi-access = free }}</ref> Eukarya present not only more tRNA gene content than the other two kingdoms but also a high variation in [[gene copy number]] among different isoacceptors, and this complexity seem to be due to duplications of tRNA genes and changes in anticodon specificity {{citation needed |date=September 2015}}.

Evolution of the tRNA gene copy number across different species has been linked to the appearance of specific tRNA modification enzymes (uridine methyltransferases in Bacteria, and adenosine deaminases in Eukarya), which increase the decoding capacity of a given tRNA.<ref name="evamaria" /> As an example, tRNA<sup>Ala</sup> encodes four different tRNA isoacceptors (AGC, UGC, GGC and CGC). In Eukarya, AGC isoacceptors are extremely enriched in gene copy number in comparison to the rest of isoacceptors, and this has been correlated with its A-to-I modification of its wobble base. This same trend has been shown for most amino acids of eukaryal species. Indeed, the effect of these two tRNA modifications is also seen in [[codon usage bias]]. Highly expressed genes seem to be enriched in codons that are exclusively using codons that will be decoded by these modified tRNAs, which suggests a possible role of these codons—and consequently of these tRNA modifications—in translation efficiency.<ref name="evamaria" />

Many species have lost specific tRNAs during evolution. For instance, both mammals and birds lack the same 14 out of the possible 64 tRNA genes, but other life forms contain these tRNAs.<ref>{{cite journal | vauthors = Ou X, Peng W, Yang Z, Cao J, Wang M, Peppelenbosch MP, Pan Q, Cheng A | title = Evolutionarily missing and conserved tRNA genes in human and avian. | journal = Infect. Genet. Evol.| volume = 85 | pages = 104460 | date = November 2020 | pmid = 32679345 | doi = 10.1016/j.meegid.2020.104460 | doi-access = free | bibcode = 2020InfGE..8504460O | hdl = 1765/129010 | hdl-access = free }}</ref> For translating codons for which an exactly pairing tRNA is missing, organisms resort to a strategy called [[Wobble base pair|wobbling]], in which imperfectly matched tRNA/mRNA pairs still give rise to translation, although this strategy also increases the propensity for translation errors.<ref>{{cite journal | vauthors = Ou X, Cao J, Cheng A, Peppelenbosch MP, Pan Q | title = Errors in translational decoding: tRNA wobbling or misincorporation? | journal = PLOS Genetics | volume = 15 | issue = 3 | pages = 2979–2986 | date = March 2019 | pmid = 21930591 | pmc = 3158919 | doi = 10.1371/journal.pgen.1008017 | doi-access = free }}</ref> The reasons why tRNA genes have been lost during evolution remains under debate but may relate improving resistance to viral infection.<ref>{{cite journal | vauthors = Ou X, Wang M, Mao S, Cao J, Cheng A, Zhu D, Chen S, Jia R, Liu M, Yang Q, Wu Y, Zhao X, Zhang S, Liu Y, Yu Y, Zhang L, Chen X, Peppelenbosch MP, Pan Q | title = Incompatible Translation Drives a Convergent Evolution and Viral Attenuation During the Development of Live Attenuated Vaccine | journal = Front. Cell. Infect. Microbiol. | volume = 8 | pages = 249 | date = July 2018 | pmid = 30073153 | pmc = 6058041 | doi = 10.3389/fcimb.2018.00249 | doi-access = free }}</ref> Because nucleotide triplets can present more combinations than there are amino acids and associated tRNAs, there is redundancy in the genetic code, and several different 3-nucleotide codons can express the same amino acid. This codon bias is what necessitates codon optimization.

==== Hypothetical origin ====
The top half of tRNA (consisting of the T arm and the acceptor stem with 5′-terminal phosphate group and 3′-terminal CCA group) and the bottom half (consisting of the D arm and the anticodon arm) are independent units in structure as well as in function. The top half may have evolved first including the 3′-terminal genomic tag which originally may have marked tRNA-like molecules for replication in early [[RNA world]]. The bottom half may have evolved later as an expansion, e.g. as protein synthesis started in RNA world and turned it into a ribonucleoprotein world ([[RNP world]]). This proposed scenario is called [[genomic tag hypothesis]]. In fact, tRNA and tRNA-like aggregates have an important catalytic influence (i.e., as [[ribozyme]]s) on replication still today. These roles may be regarded as '[[molecular fossil|molecular (or chemical) fossils]]' of RNA world.<ref name="MW_GenomicTag">{{cite book| first1= Nancy| last1= Maizels| first2= Alan M.| last2= Weiner| chapter-url= http://citeseerx.ist.psu.edu/viewdoc/summary?doi=10.1.1.708.7795 |chapter= The Genomic Tag Hypothesis – What Molecular Fossils Tell Us about the Evolution of tRNA| title= The RNA World| edition= 2nd| year= 1999| publisher= Cold Spring Harbor Laboratory Press | citeseerx= 10.1.1.708.7795|isbn= 978-0-87969-561-3| access-date= February 16, 2024}}</ref> In March 2021, researchers reported evidence suggesting that an early form of transfer RNA could have been a replicator [[ribozyme]] molecule in the very early development of life, or [[abiogenesis]].<ref name="EL-20210302">{{cite journal |last1=Kühnlein |first1=Alexandra |last2=Lanzmich |first2=Simon A. |last3=Brun |first3=Dieter |title=tRNA sequences can assemble into a replicator |doi=10.7554/eLife.63431 |date=2 March 2021 |journal=[[eLife]] |volume=10 |pmid=33648631 |pmc=7924937 |doi-access=free }}</ref><ref name="STD-20210403">{{cite news |last=Maximilian |first=Ludwig |title=Solving the Chicken-and-the-Egg Problem – "A Step Closer to the Reconstruction of the Origin of Life" |url=https://scitechdaily.com/solving-the-chicken-and-the-egg-problem-a-step-closer-to-the-reconstruction-of-the-origin-of-life/ |date=3 April 2021 |work=[[SciTech (magazine)|SciTechDaily]] |accessdate=3 April 2021 }}</ref>

Evolution of type I and type II tRNAs is explained to the last nucleotide by the three 31 nucleotide minihelix tRNA evolution theorem, which also describes the pre-life to life transition on Earth.<ref>{{cite journal |journal=Life |title=The 3 31 Nucleotide Minihelix tRNA Evolution Theorem and the Origin of Life |doi=10.3390/life13112224 |doi-access=free |date=2023 |last1=Lei |first1=Lei |last2=Burton |first2=Zachary Frome |volume=13 |issue=11 |page=2224 |pmid=38004364 |pmc=10672568 |bibcode=2023Life...13.2224L }}</ref><ref>{{cite journal |journal=Transcription |last1=Lei |first1=Lei |last2=Burton |first2=Zachary |title=Evolution of the genetic code |doi=10.1080/21541264.2021.1927652 |date=2021 |volume=12 |issue=1 |pages=28–53 |pmid=34000965 |pmc=8172153 }}</ref><ref>{{cite journal |journal=Life |last1=Lei |first1=Lei |last2=Burton |first2=Zachary |title=Evolution of Life on Earth: tRNA, Aminoacyl-tRNA Synthetases and the Genetic Code |doi=10.3390/life10030021 |doi-access=free |date=2021 |volume=10 |issue=3 |page=21 |pmid=32131473 |pmc=7151597 }}</ref><ref>{{cite journal |journal=J Mol Evol |last1=Burton |first1=Zachary |title= The 3-Minihelix tRNA Evolution Theorem |doi=10.1007/s00239-020-09928-2 |date=2020 |volume=88 |issue=3 |pages=234–242 |pmid=32020280 |bibcode=2020JMolE..88..234B }}</ref><ref>{{cite journal |journal=Life | last1=Kim |first1=Yunsoo |last2=Opron |first2=Kristopher |last3=Burton |first3=Zachary |title= A tRNA- and Anticodon-Centric View of the Evolution of Aminoacyl-tRNA Synthetases, tRNAomes, and the Genetic Code | doi= 10.3390/life9020037 |date=2019 |volume=9 |issue=2 |page=37 |doi-access=free |pmid=31060233 |pmc=6616430 | bibcode=2019Life....9...37K }}</ref> Three 31 nucleotide minihelices of known sequence were ligated in pre-life to generate a 93 nucleotide tRNA precursor. In pre-life, a 31 nucleotide D loop minihelix (GCGGCGGUAGCCUAGCCUAGCCUACCGCCGC) was ligated to two 31 nucleotide anticodon loop minihelices (GCGGCGGCCGGGCU/???AACCCGGCCGCCGC; / indicates a U-turn conformation in the RNA backbone; ? indicates unknown base identity) to form the 93 nucleotide tRNA precursor. To generate type II tRNAs, a single internal 9 nucleotide deletion occurred within ligated acceptor stems (CCGCCGCGCGGCGG goes to GGCGG). To generate type I tRNAs, an additional, related 9 nucleotide deletion occurred within ligated acceptor stems within the variable loop region (CCGCCGCGCGGCGG goes to CCGCC). These two 9 nucleotide deletions are identical on complementary RNA strands. tRNAomes (all of the tRNAs of an organism) were generated by duplication and mutation.

Very clearly, life evolved from a polymer world that included RNA repeats and RNA inverted repeats (stem-loop-stems). Of particular importance were the 7 nucleotide U-turn loops (CU/???AA). After LUCA (the last universal common (cellular) ancestor), the T loop evolved to interact with the D loop at the tRNA “elbow” (T loop: UU/CAAAU, after LUCA). Polymer world progressed to minihelix world to tRNA world, which has endured for ~4 billion years. Analysis of tRNA sequences reveals a major successful pathway in evolution of life on Earth.